Stem-loop sequence efu-mir-128b

AccessionMI0028690 (change log)
DescriptionEptesicus fuscus miR-128b stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   --   u      uuc       uag      cu       u 
5'   agc guugga   ggggccg   cacugu  gagaggu u
     ||| ||||||   |||||||   ||||||  |||||||  
3'   ucg cgacuu   cucuggc   gugaca  cucuuua a
   cu   u      uuu       caa      --       c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977631.1: 10863595-10863674 [+]
intergenic
Database links

Mature sequence efu-miR-128b

Accession MIMAT0035005
Sequence

48 - 

ucacagugaaccggucucuuuuu

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).