Stem-loop sequence efu-mir-128b

AccessionMI0028690
DescriptionEptesicus fuscus miR-128b stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   ------auu    uu uuccu    u      uuc       uag      cu       u 
5'          ggcc  g     gagc guugga   ggggccg   cacugu  gagaggu u
            ||||  |     |||| ||||||   |||||||   ||||||  |||||||  
3'          ucgg  c     uucg cgacuu   cucuggc   gugaca  cucuuua a
   cauuuuucu    uc -----    u      uuu       caa      --       c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0) Overlapping transcripts
JH977631.1: 10863579-10863689 [+]
intergenic

Mature sequence efu-miR-128b

Accession MIMAT0035005
Sequence

64 - 

ucacagugaaccggucucuuuuu

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large Numbers of Novel miRNAs Originate from DNA Transposons and Are Coincident with a Large Species Radiation in Bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. [Epub prior to print](2014).