Stem-loop sequence efu-let-7f

AccessionMI0028702 (change log)
DescriptionEptesicus fuscus let-7f stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ----   au   a ug                      ---------       u 
5'     ucu  cag g  agguaguagauuguauaguugu         gggguag u
       |||  ||| |  ||||||||||||||||||||||         ||||||| a
3'     agg  guc c  uccguuaucuaacauaucaaua         ucccauu u
   gaug   -c   - cu                      gaggacuug       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977714.1: 1024362-1024459 [+]
intergenic
Clustered miRNAs
< 10kb from efu-let-7f
efu-let-7fJH977714.1: 1024362-1024459 [+]
efu-let-7dJH977714.1: 1026627-1026722 [+]
Database links

Mature sequence efu-let-7f

Accession MIMAT0035017
Sequence

11 - 

ugagguaguagauuguauaguugug

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).