Stem-loop sequence efu-mir-495

AccessionMI0028716 (change log)
DescriptionEptesicus fuscus miR-495 stem-loop
Gene family MIPF0000110; mir-329
Stem-loop
   - u     -a        u  -       cu     -  ua 
5'  g uccug  aaagaagu gc ccauguu  uuucg cg  a
    | |||||  |||||||| || |||||||  ||||| ||  u
3'  c agggc  uuucuuca cg gguacaa  aaagc gu  a
   a u     cc        -  u       ac     a  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977717.1: 859846-859925 [-]
intergenic
Clustered miRNAs
< 10kb from efu-mir-495
efu-mir-299JH977717.1: 868334-868406 [-]
efu-mir-411JH977717.1: 866940-867017 [-]
efu-mir-323JH977717.1: 866392-866469 [-]
efu-mir-494JH977717.1: 863147-863222 [-]
efu-mir-1193JH977717.1: 862748-862824 [-]
efu-mir-495JH977717.1: 859846-859925 [-]
efu-mir-3958JH977717.1: 858317-858394 [-]
efu-mir-376JH977717.1: 855568-855645 [-]
efu-mir-1185JH977717.1: 852489-852568 [-]
efu-mir-381JH977717.1: 850848-850930 [-]
Database links

Mature sequence efu-miR-495

Accession MIMAT0035031
Sequence

48 - 

aaacaaacauggugcacuucuuu

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).