Stem-loop sequence efu-mir-3958

AccessionMI0028718 (change log)
DescriptionEptesicus fuscus miR-3958 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   --uguuc            u     au         uug 
5'        gaaaggagguug ccgug  guauuugcu   a
          |||||||||||| |||||  |||||||||    
3'        cuuuucucuagu ggcac  uauagacgg   u
   ccuacuc            u     gu         uag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977717.1: 858317-858394 [-]
intergenic
Clustered miRNAs
< 10kb from efu-mir-3958
efu-mir-411JH977717.1: 866940-867017 [-]
efu-mir-323JH977717.1: 866392-866469 [-]
efu-mir-494JH977717.1: 863147-863222 [-]
efu-mir-1193JH977717.1: 862748-862824 [-]
efu-mir-495JH977717.1: 859846-859925 [-]
efu-mir-3958JH977717.1: 858317-858394 [-]
efu-mir-376JH977717.1: 855568-855645 [-]
efu-mir-1185JH977717.1: 852489-852568 [-]
efu-mir-381JH977717.1: 850848-850930 [-]
Database links

Mature sequence efu-miR-3958

Accession MIMAT0035033
Sequence

45 - 

cagauauugcacgguugaucucuu

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).