Stem-loop sequence efu-mir-485

AccessionMI0028723 (change log)
DescriptionEptesicus fuscus miR-485 stem-loop
Gene family MIPF0000201; mir-485
Stem-loop
   --     ug        cu       -    a    auuc 
5'   guacu  gagagagg  ggccgug auga uucg    a
     |||||  ||||||||  ||||||| |||| ||||    u
3'   uauga  uucucucc  ucggcac uacu gagc    c
   ac     uu        uc       a    -    gaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977717.1: 841215-841293 [-]
intergenic
Clustered miRNAs
< 10kb from efu-mir-485
efu-mir-381JH977717.1: 850848-850930 [-]
efu-mir-487JH977717.1: 845018-845095 [-]
efu-mir-382JH977717.1: 842272-842348 [-]
efu-mir-485JH977717.1: 841215-841293 [-]
efu-mir-154JH977717.1: 836837-836917 [-]
efu-mir-409JH977717.1: 833062-833137 [-]
efu-mir-412JH977717.1: 832912-832986 [-]
Database links

Mature sequence efu-miR-485

Accession MIMAT0035038
Sequence

48 - 

gucauacacggcucuccucucu

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).