Stem-loop sequence efu-mir-487

AccessionMI0028727 (change log)
DescriptionEptesicus fuscus miR-487 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   --    u     g   uua      c    -    - ugu 
5'   uacu gaaga ugg   ucccug ugug uucg c   a
     |||| ||||| |||   |||||| |||| |||| |   u
3'   auga uuuuu acc   agggac auac aagc g   u
   cu    c     g   uac      -    u    a ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977717.1: 845018-845095 [-]
intergenic
Clustered miRNAs
< 10kb from efu-mir-487
efu-mir-1185JH977717.1: 852489-852568 [-]
efu-mir-381JH977717.1: 850848-850930 [-]
efu-mir-487JH977717.1: 845018-845095 [-]
efu-mir-382JH977717.1: 842272-842348 [-]
efu-mir-485JH977717.1: 841215-841293 [-]
efu-mir-154JH977717.1: 836837-836917 [-]
Database links

Mature sequence efu-miR-487

Accession MIMAT0035042
Sequence

11 - 

gugguuaucccugcuguguucg

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).