Stem-loop sequence efu-let-7e

AccessionMI0028898 (change log)
DescriptionEptesicus fuscus let-7e stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   --ccc  c   cu   g                u  ----g a  a 
5'      cc ggg  gag uaggagguuguauagu ga     g gg c
        || |||  ||| |||||||||||||||| ||     | ||  
3'      gg ccc  uuc auccuccggcauauca cu     c cc a
   gcguc  a   cu   g                -  agagg a  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977711.1: 794288-794374 [-]
intergenic
Clustered miRNAs
< 10kb from efu-let-7e
efu-mir-99bJH977711.1: 794487-794566 [-]
efu-let-7eJH977711.1: 794288-794374 [-]
Database links

Mature sequence efu-let-7e

Accession MIMAT0035186
Sequence

11 - 

ugagguaggagguuguauaguuga

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).