Stem-loop sequence dme-mir-9369

AccessionMI0028918 (change log)
DescriptionDrosophila melanogaster miR-9369 stem-loop
Stem-loop
   ---         -------        -    -  u 
5'    agcgagagg       guauuaug uauu ca a
      |||||||||       |||||||| |||| ||  
3'    ucgcuuucc       cauaguac auaa gu u
   auc         ucuuaua        u    u  u 
Get sequence
Deep sequencing
357 reads, 34.5 reads per million, 29 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 19551318-19551379 [+]
intergenic
Clustered miRNAs
< 10kb from dme-mir-9369
dme-mir-972chrX: 19551152-19551242 [+]
dme-mir-9369chrX: 19551318-19551379 [+]
dme-mir-973chrX: 19551528-19551628 [+]
dme-mir-974chrX: 19551678-19551778 [+]
dme-mir-2499chrX: 19557008-19557103 [+]
dme-mir-4966chrX: 19558370-19558496 [+]
dme-mir-975chrX: 19558753-19558843 [+]
dme-mir-976chrX: 19558895-19558991 [+]
dme-mir-977chrX: 19559022-19559120 [+]
dme-mir-978chrX: 19561236-19561327 [+]
Database links

Mature sequence dme-miR-9369-5p

Accession MIMAT0035201
Sequence

1 - 

agcgagaggguauuauguauuca

 - 23

Get sequence
Deep sequencing218 reads, 23 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence dme-miR-9369-3p

Accession MIMAT0035202
Sequence

40 - 

auacauauucuccuuucgcu

 - 59

Get sequence
Deep sequencing139 reads, 19 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).