Stem-loop sequence dme-mir-9370

AccessionMI0028919 (change log)
DescriptionDrosophila melanogaster miR-9370 stem-loop
Stem-loop
   ---uu       cc    c    ug 
5'      uggguug  ggua cggg  g
        |||||||  |||| ||||  u
3'      acccagc  cuau gccc  u
   accau       ac    a    cu 
Get sequence
Deep sequencing
417 reads, 0 reads per million, 41 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 11710252-11710301 [-]
sense
FBtr0073615 ; Amun-RB; 3'UTR (exon 4)
FBtr0073619 ; Amun-RA; 3'UTR (exon 4)
Database links

Mature sequence dme-miR-9370-5p

Accession MIMAT0035203
Sequence

1 - 

uuuggguugccgguaccgggug

 - 22

Get sequence
Deep sequencing403 reads, 38 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence dme-miR-9370-3p

Accession MIMAT0035204
Sequence

28 - 

cccgauauccacgacccauacc

 - 49

Get sequence
Deep sequencing11 reads, 8 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).