Stem-loop sequence dme-mir-9371

AccessionMI0028920 (change log)
DescriptionDrosophila melanogaster miR-9371 stem-loop
Stem-loop
   ---           cuug      acauuga 
5'    aaaucacuuug    gaauuc       u
      |||||||||||    ||||||        
3'    uuuggugaagc    cuuaag       g
   guc           acua      aaugcau 
Get sequence
Deep sequencing
125 reads, 0 reads per million, 35 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 9989120-9989180 [+]
sense
FBtr0333686 ; Glut4EF-RH; exon 7
FBtr0305157 ; Glut4EF-RF; exon 7
Database links

Mature sequence dme-miR-9371-5p

Accession MIMAT0035205
Sequence

1 - 

aaaucacuuugcuuggaauuca

 - 22

Get sequence
Deep sequencing27 reads, 16 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence dme-miR-9371-3p

Accession MIMAT0035206
Sequence

39 - 

aauucaucacgaagugguuucu

 - 60

Get sequence
Deep sequencing96 reads, 33 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).