Stem-loop sequence dme-mir-9372

AccessionMI0028921 (change log)
DescriptionDrosophila melanogaster miR-9372 stem-loop
Stem-loop
   ---       a  -uu    c  c   -u  ac 
5'    uaaaagc ca   ucgc ag acg  gu  u
      ||||||| ||   |||| || |||  ||  u
3'    auuuuug gu   agug uc ugc  ca  u
   gca       -  uuu    -  -   uc  cc 
Get sequence
Deep sequencing
130 reads, 0 reads per million, 32 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 633691-633751 [-]
sense
FBtr0114561 ; Dredd-RF; 3'UTR (exon 4)
FBtr0114559 ; Dredd-RD; 3'UTR (exon 5)
FBtr0114560 ; Dredd-RE; 3'UTR (exon 5)
Database links

Mature sequence dme-miR-9372-5p

Accession MIMAT0035207
Sequence

1 - 

uaaaagcacauuucgccagcacgu

 - 24

Get sequence
Deep sequencing100 reads, 29 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence dme-miR-9372-3p

Accession MIMAT0035208
Sequence

38 - 

cgucugugauuuugguuuuuaac

 - 60

Get sequence
Deep sequencing30 reads, 17 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).