Stem-loop sequence dme-mir-9373

AccessionMI0028922 (change log)
DescriptionDrosophila melanogaster miR-9373 stem-loop
Stem-loop
   ----    u  g       uuc  c -   a 
5'     aguu gu aggagcg   gg g gau c
       |||| || |||||||   || | |||  
3'     ucga cg uucucgc   cc c cua a
   cugc    c  g       uac  a g   c 
Get sequence
Deep sequencing
25 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 19621080-19621138 [-]
sense
FBtr0083807 ; CG6231-RC; intron 1
FBtr0083808 ; CG6231-RD; intron 1
FBtr0083809 ; CG6231-RB; intron 1
FBtr0083810 ; CG6231-RA; 5'UTR (exon 1)
Database links

Mature sequence dme-miR-9373-5p

Accession MIMAT0035209
Sequence

1 - 

aguuugugaggagcguucggc

 - 21

Get sequence
Deep sequencing8 reads, 7 experiments
Evidence experimental; Illumina [1]

Mature sequence dme-miR-9373-3p

Accession MIMAT0035210
Sequence

38 - 

caucgcucuuggccagcucgu

 - 58

Get sequence
Deep sequencing15 reads, 10 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).