Stem-loop sequence dme-mir-9375

AccessionMI0028924 (change log)
DescriptionDrosophila melanogaster miR-9375 stem-loop
Stem-loop
   --cc    -    g  a    u    -     
5'     gagu auau ga uuuc guuu ugcc 
       |||| |||| || |||| |||| ||| u
3'     cuua uaua cu aaag caag auga 
   aaga    a    g  c    c    u     
Get sequence
Deep sequencing
154 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 6451551-6451609 [-]
sense
FBtr0081730 ; CG9727-RA; 3'UTR (exon 4)
FBtr0330192 ; CG9727-RB; 3'UTR (exon 4)
FBtr0330193 ; CG9727-RC; 3'UTR (exon 5)
Database links

Mature sequence dme-miR-9375-5p

Accession MIMAT0035213
Sequence

1 - 

ccgaguauauggaauuucuguu

 - 22

Get sequence
Deep sequencing116 reads, 26 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence dme-miR-9375-3p

Accession MIMAT0035214
Sequence

37 - 

ccgaaacucgauauaauucaga

 - 58

Get sequence
Deep sequencing35 reads, 20 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).