Stem-loop sequence dme-mir-9376

AccessionMI0028925 (change log)
DescriptionDrosophila melanogaster miR-9376 stem-loop
Stem-loop
   aua    g   g  caaag  cu      aag     c 
5'    gcca cau gc     cg  gugcuu   ugguc a
      |||| ||| ||     ||  ||||||   ||||| a
3'    cggu gug cg     gu  cacgaa   gccag g
   -ac    g   g  uacca  uu      --a     c 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 22946867-22946942 [+]
intergenic
Database links

Mature sequence dme-miR-9376-5p

Accession MIMAT0035215
Sequence

1 - 

auagccagcauggccaaagcgcu

 - 23

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence dme-miR-9376-3p

Accession MIMAT0035216
Sequence

55 - 

uuugaccaugcggugguggcc

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).