Stem-loop sequence dme-mir-9377

AccessionMI0028926 (change log)
DescriptionDrosophila melanogaster miR-9377 stem-loop
Stem-loop
   -- g               u    ug 
5'   c cucuuucucucuauc ggcc  g
     | ||||||||||||||| ||||   
3'   g gaggaagagggguag ucgg  c
   gg a               u    uc 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 12665217-12665268 [+]
sense
FBtr0073684 ; Tis11-RB; intron 2
FBtr0073683 ; Tis11-RA; intron 2
FBtr0333756 ; Tis11-RC; intron 2
Database links

Mature sequence dme-miR-9377-5p

Accession MIMAT0035217
Sequence

1 - 

cgcucuuucucucuaucuggcc

 - 22

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence dme-miR-9377-3p

Accession MIMAT0035218
Sequence

31 - 

cuugauggggagaaggagagg

 - 51

Get sequence
Deep sequencing8 reads, 7 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).