Stem-loop sequence dme-mir-9378

AccessionMI0028927 (change log)
DescriptionDrosophila melanogaster miR-9378 stem-loop
Stem-loop
   ---       u     c  ga      ---g  a 
5'    aguggag gagac uc  guucgg    ca a
      ||||||| ||||| ||  ||||||    ||  
3'    uuaccuc cuuug ag  caagcc    gu u
   ggg       -     -  gg      gaua  c 
Get sequence
Deep sequencing
104 reads, 0 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 10751877-10751938 [-]
sense
FBtr0080118 ; CG17124-RB; intron 1
FBtr0080117 ; CG17124-RA; intron 1
Clustered miRNAs
< 10kb from dme-mir-9378
dme-mir-9378chr2L: 10751877-10751938 [-]
dme-mir-4970chr2L: 10741885-10741987 [+]
Database links

Mature sequence dme-miR-9378-5p

Accession MIMAT0035219
Sequence

1 - 

aguggagugagaccucgaguucgg

 - 24

Get sequence
Deep sequencing93 reads, 26 experiments
Evidence experimental; Illumina [1]

Mature sequence dme-miR-9378-3p

Accession MIMAT0035220
Sequence

40 - 

gaacgggaguuuccuccauugg

 - 61

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).