Stem-loop sequence dme-mir-9379

AccessionMI0028928 (change log)
DescriptionDrosophila melanogaster miR-9379 stem-loop
Stem-loop
   --  ca           -aau    ua  a 
5'   cg  ugucagguggu    ccau  gu u
     ||  |||||||||||    ||||  ||  
3'   gc  acaguucaccg    ggua  ca a
   cg  ug           guau    --  a 
Get sequence
Deep sequencing
41 reads, 0 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 13852845-13852901 [-]
antisense
FBtr0087640 ; CG30485-RA; exon 1
Database links

Mature sequence dme-miR-9379-5p

Accession MIMAT0035221
Sequence

1 - 

cgcaugucaggugguaaucca

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dme-miR-9379-3p

Accession MIMAT0035222
Sequence

37 - 

uauggccacuugacagucgg

 - 56

Get sequence
Deep sequencing24 reads, 14 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).