Stem-loop sequence dme-mir-9380

AccessionMI0028929 (change log)
DescriptionDrosophila melanogaster miR-9380 stem-loop
Stem-loop
   g  c      c       ---    -aua    uc    c 
5'  cu cugcug aucuguu   ggcg    gcgc  guca u
    || |||||| |||||||   ||||    ||||  ||||  
3'  ga gacgac uagacaa   ccgc    ugug  cggu c
   a  c      c       ccu    cuca    -c    u 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 8348702-8348778 [-]
antisense
FBtr0081842 ; CG7352-RA; 3'UTR (exon 2)
FBtr0302314 ; CG7352-RC; 3'UTR (exon 3)
Database links

Mature sequence dme-miR-9380-5p

Accession MIMAT0035223
Sequence

1 - 

gcuccugcugcaucuguuggcg

 - 22

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence dme-miR-9380-3p

Accession MIMAT0035224
Sequence

55 - 

ccuccaacagauccagcagcag

 - 76

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).