Stem-loop sequence dme-mir-9381

AccessionMI0028930 (change log)
DescriptionDrosophila melanogaster miR-9381 stem-loop
Stem-loop
   ---        a  gu        gaucccuugcccc 
5'    gccaggga gg  cgagugcg             a
      |||||||| ||  ||||||||             g
3'    cggucccu cc  gcucacgc             c
   acu        a  ug        guccgcuuaucgg 
Get sequence
Deep sequencing
27 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 23983496-23983569 [+]
sense
FBtr0308923 ; CR31451-RD; exon 1
FBtr0308922 ; CR31451-RC; exon 1
Database links

Mature sequence dme-miR-9381-5p

Accession MIMAT0035225
Sequence

1 - 

gccagggaagggucgagugc

 - 20

Get sequence
Deep sequencing11 reads, 9 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence dme-miR-9381-3p

Accession MIMAT0035226
Sequence

49 - 

ugcgcacucgguccaucccugg

 - 70

Get sequence
Deep sequencing15 reads, 8 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).