Stem-loop sequence dme-mir-9382

AccessionMI0028931 (change log)
DescriptionDrosophila melanogaster miR-9382 stem-loop
Stem-loop
   ---         ug    a      ccacuuuccu 
5'    aucacagug  gcug gggauu          u
      |||||||||  |||| ||||||          a
3'    uagugucac  cggc cccuag          u
   ugc         cg    -      ccguuuucaa 
Get sequence
Deep sequencing
26 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2L: 12724957-12725025 [+]
sense
FBtr0090013 ; MRP-RA; intron 4
FBtr0090016 ; MRP-RD; intron 4
FBtr0090017 ; MRP-RE; intron 4
FBtr0090018 ; MRP-RF; intron 4
FBtr0090020 ; MRP-RH; intron 4
FBtr0090021 ; MRP-RI; intron 4
FBtr0090024 ; MRP-RL; intron 4
FBtr0090029 ; MRP-RQ; intron 4
FBtr0090014 ; MRP-RB; intron 4
FBtr0090015 ; MRP-RC; intron 5
FBtr0090019 ; MRP-RG; intron 5
FBtr0090022 ; MRP-RJ; intron 5
FBtr0090023 ; MRP-RK; intron 5
FBtr0090025 ; MRP-RM; intron 5
FBtr0090026 ; MRP-RN; intron 5
FBtr0090027 ; MRP-RO; intron 5
FBtr0090028 ; MRP-RP; intron 5
Database links

Mature sequence dme-miR-9382-5p

Accession MIMAT0035227
Sequence

1 - 

aucacaguguggcugagggau

 - 21

Get sequence
Deep sequencing20 reads, 13 experiments
Evidence experimental; Illumina [1]

Mature sequence dme-miR-9382-3p

Accession MIMAT0035228
Sequence

47 - 

auccccggcgccacugugaucg

 - 68

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).