Stem-loop sequence dme-mir-9383

AccessionMI0028932 (change log)
DescriptionDrosophila melanogaster miR-9383 stem-loop
Stem-loop
   ---    g     -c   u          cau 
5'    gggu cagau  aag gcgagcugcg   u
      |||| |||||  ||| ||||||||||    
3'    ccca gucua  uuc cgcuugacgc   c
   agc    a     ac   -          ucu 
Get sequence
Deep sequencing
65 reads, 0 reads per million, 24 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 15221795-15221855 [+]
sense
FBtr0083051 ; CG12241-RA; 3'UTR (exon 3)
Database links

Mature sequence dme-miR-9383-5p

Accession MIMAT0035229
Sequence

1 - 

gggugcagaucaagugcgagcu

 - 22

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence dme-miR-9383-3p

Accession MIMAT0035230
Sequence

39 - 

uucgccuucaaucugaaccccg

 - 60

Get sequence
Deep sequencing63 reads, 23 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).