Stem-loop sequence dme-mir-9384

AccessionMI0028933 (change log)
DescriptionDrosophila melanogaster miR-9384 stem-loop
Stem-loop
   ----ag       uc   u       cuaca 
5'       gcauaau  aac cacacgu     g
         |||||||  ||| |||||||      
3'       uguauug  uug gugugua     g
   guuuca       gc   u       uacau 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3R: 4748664-4748723 [-]
sense
FBtr0089955 ; tacc-RA; intron 1
FBtr0302614 ; tacc-RI; intron 1
FBtr0302615 ; tacc-RJ; intron 1
FBtr0332446 ; tacc-RN; intron 1
Database links

Mature sequence dme-miR-9384-5p

Accession MIMAT0035231
Sequence

1 - 

aggcauaauucaacucacacgu

 - 22

Get sequence
Deep sequencing10 reads, 6 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence dme-miR-9384-3p

Accession MIMAT0035232
Sequence

38 - 

uguguguucgguuauguacuuu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).