Stem-loop sequence dme-mir-9388

AccessionMI0028938 (change log)
DescriptionDrosophila melanogaster miR-9388 stem-loop
Stem-loop
   --caa      ug                    a      --       
5'      guauuu  guacguauguauguauguac uacaug  uguaua 
        ||||||  |||||||||||||||||||| ||||||  ||||| u
3'      caugaa  uauguauacauacauacaug auguac  acaugg 
   gcaug      cg                    -      uu       
Get sequence
Deep sequencing
1926 reads, 57.9 reads per million, 19 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr3L: 22945116-22945207 [+]
intergenic
Database links

Mature sequence dme-miR-9388-5p

Accession MIMAT0035238
Sequence

16 - 

guauguauguauguacauacaug

 - 38

Get sequence
Deep sequencing60 reads, 9 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence dme-miR-9388-3p

Accession MIMAT0035239
Sequence

56 - 

uguaguacauacauacauaugu

 - 77

Get sequence
Deep sequencing1861 reads, 18 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).