Stem-loop sequence xtr-mir-9406

AccessionMI0028999
DescriptionXenopus tropicalis miR-9406 stem-loop
Stem-loop
   ----g   gc   cucca    u      -ucaga     cuuccccagc 
5'      uca  cug     uaca gccagc      gcugc          a
        |||  |||     |||| ||||||      |||||          u
3'      agu  gac     augu ugguug      cgacg          c
   gacca   --   -aaac    u      ucuaaa     aaauccacuu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173972.1: 20811-20905 [-]
intergenic

Mature sequence xtr-miR-9406

Accession MIMAT0035360
Sequence

61 - 

agcaaaucuguugguuuguacaaac

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24065776 "Small RNA profiling of Xenopus embryos reveals novel miRNAs and a new class of small RNAs derived from intronic transposable elements" Harding JL, Horswell S, Heliot C, Armisen J, Zimmerman LB, Luscombe NM, Miska EA, Hill CS Genome Res. 24:96-106(2014).