Stem-loop sequence xtr-mir-9407

AccessionMI0029000 (change log)
DescriptionXenopus tropicalis miR-9407 stem-loop
Stem-loop
   ------------   c               ug        a    a    a 
5'             ggg guggccugcgcucgg  gauagaag cgug ucua g
               ||| |||||||||||||||  |||||||| |||| |||| g
3'             ccc caccggaugcgagcc  cuaucuuc gcac agau c
   uuuuuauuaccc   a               gu        a    a    u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr7: 25022371-25022465 [-]
intergenic
Database links

Mature sequence xtr-miR-9407

Accession MIMAT0035361
Sequence

11 - 

ugcgcucgguggauagaagacguga

 - 35

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:24065776 "Small RNA profiling of Xenopus embryos reveals novel miRNAs and a new class of small RNAs derived from intronic transposable elements" Harding JL, Horswell S, Heliot C, Armisen J, Zimmerman LB, Luscombe NM, Miska EA, Hill CS Genome Res. 24:96-106(2014).