Stem-loop sequence xtr-mir-428b

AccessionMI0029001 (change log)
DescriptionXenopus tropicalis miR-428b stem-loop
Stem-loop
   -----------    -     cag     a   -      u  g   ug  ac 
5'            cugg gcuca   cagcc aac agaagc cu ucu  ug  u
              |||| |||||   ||||| ||| |||||| || |||  ||   
3'            ggcc cgggu   gucgg uug ucuucg ga aga  au  c
   gacugcuaaag    a     uua     c   c      u  a   gu  cu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
KV460579.1: 115024-115118 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-428b
xtr-mir-428aKV460579.1: 115424-115494 [-]
xtr-mir-428bKV460579.1: 115024-115118 [-]
Database links

Mature sequence xtr-miR-428b

Accession MIMAT0035362
Sequence

48 - 

gagaaagugcuucucguucggcuga

 - 72

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:24065776 "Small RNA profiling of Xenopus embryos reveals novel miRNAs and a new class of small RNAs derived from intronic transposable elements" Harding JL, Horswell S, Heliot C, Armisen J, Zimmerman LB, Luscombe NM, Miska EA, Hill CS Genome Res. 24:96-106(2014).