Stem-loop sequence sly-MIR9476

AccessionMI0029118 (change log)
DescriptionSolanum lycopersicum miR9476 stem-loop
Literature search

1 open access papers mention sly-MIR9476
(2 sentences)

Stem-loop
     u     aaa                                c       ccg 
5' cc gucca   cugcuauuggucuaguccugcaucuuuuuuua auuuuuu   u
   || |||||   |||||||||||||||||||||||||||||||| |||||||    
3' gg uaggu   gacgauaaccagaucaggacguagaaaaaaau uaaaaaa   u
     u     -ag                                a       cua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr1: 88110498-88110606 [-]
intergenic
Database links

Mature sequence sly-miR9476-5p

Accession MIMAT0035469
Sequence

22 - 

ucuaguccugcaucuuuuuuu

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sly-miR9476-3p

Accession MIMAT0035470
Sequence

71 - 

aaaaagaugcaggacuagacc

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).