Stem-loop sequence bdi-MIR9480a

AccessionMI0029127 (change log)
DescriptionBrachypodium distachyon miR9480a stem-loop
Stem-loop
   --       agauaa  ua      --g        u 
5'   ccuuaca      ca  uaccac   uacauacu a
     |||||||      ||  ||||||   ||||||||  
3'   ggagugu      gu  auggug   guguaugg a
   ug       --guaa  ca      gga        g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 31011548-31011617 [-]
intergenic
Database links

Mature sequence bdi-miR9480a

Accession MIMAT0035485
Sequence

39 - 

uaugugagggugguaacugaa

 - 59

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).