Stem-loop sequence bdi-MIR9481a

AccessionMI0029129 (change log)
DescriptionBrachypodium distachyon miR9481a stem-loop
Gene family MIPF0002096; MIR9481
Stem-loop
   --    a          c  gg    u        --a      uuu        ---a    g 
5'   ugca auucggaggu ag  auuc acugauuu   acuaaa   cauccggc    aagu a
     |||| |||||||||| ||  |||| ||||||||   ||||||   ||||||||    |||| a
3'   acgu uaagcuucca uc  uagg ugacuaaa   ugauuu   guaggcug    uuca a
   cu    c          c  uu    c        ggg      -uu        caug    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 4930203-4930325 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR9481a
bdi-MIR9481a4: 4930203-4930325 [-]
bdi-MIR9481b4: 4929512-4929646 [-]
Database links

Mature sequence bdi-miR9481a

Accession MIMAT0035487
Sequence

92 - 

ucagucggauuucucaccuucgaa

 - 115

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).