Stem-loop sequence bdi-MIR9482

AccessionMI0029130 (change log)
DescriptionBrachypodium distachyon miR9482 stem-loop
Stem-loop
   --aaucaac     -a    u     -a     c   c   ug      a    u  ga  --   uuu  --u     g 
5'          ggcac  gcuu cuugg  ucccu ucu ccu  aaggcu uuuu ug  ca  ggu   ca   gugca u
            |||||  |||| |||||  ||||| ||| |||  |||||| |||| ||  ||  |||   ||   |||||  
3'          cugug  cgaa gaacc  aggga aga ggg  uuccga agaa ac  gu  ccg   gu   uacgu u
   uguuuguac     ac    c     aa     -   a   gu      g    c  aa  au   uuu  uac     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 18009072-18009224 [-]
intergenic
Database links

Mature sequence bdi-miR9482

Accession MIMAT0035488
Sequence

108 - 

ccuuuggggaagaagggaaac

 - 128

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).