Stem-loop sequence bdi-MIR9483a

AccessionMI0029131 (change log)
DescriptionBrachypodium distachyon miR9483a stem-loop
Gene family MIPF0001996; MIR9483
Literature search

1 open access papers mention bdi-MIR9483a
(2 sentences)

Stem-loop
   --     c     u      c               g      g    -     -    c    aug        a    uac     aa 
5'   aaucu guagg gcuuca aggaaacaguucaau uuugcu gaau ggaaa auau guuc   ucuaaaug ggcc   aaagc  g
     ||||| ||||| |||||| ||||||||||||||| |||||| |||| ||||| |||| ||||   |||||||| ||||   |||||  c
3'   uuaga cgucc ugaagu uccuuugucaaguug aaauga cuua cuuuu uaua uaag   agguuugc ucgg   uuucg  u
   cu     -     u      c               a      a    a     c    -    aga        a    ---     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 2804863-2805036 [-]
intergenic
Database links

Mature sequence bdi-miR9483a

Accession MIMAT0035489
Sequence

141 - 

uugaacuguuuccucugaaguucc

 - 164

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).