Stem-loop sequence bdi-MIR9486a

AccessionMI0029135 (change log)
DescriptionBrachypodium distachyon miR9486a stem-loop
Gene family MIPF0002054; MIR9486
Literature search

1 open access papers mention bdi-MIR9486a
(1 sentences)

Stem-loop
   --uc     -    a         a   c               -            g 
5'     aaagg ggaa ccucuaauc cuu aaggcauuuuaugaa gaaaaaacccug a
       ||||| |||| ||||||||| ||| ||||||||||||||| ||||||||||||  
3'     uuucc ccuu ggagauuag gaa uuucguaaaauacuu cuuuuuugggac u
   auac     a    -         g   c               u            c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 7498369-7498481 [-]
intergenic
Database links

Mature sequence bdi-miR9486a

Accession MIMAT0035493
Sequence

79 - 

augcuuucaagggauuagagguuc

 - 102

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).