Stem-loop sequence bdi-MIR9487

AccessionMI0029136 (change log)
DescriptionBrachypodium distachyon miR9487 stem-loop
Stem-loop
   --   uccu    c                  au       uaccucauaacgu           ----      u      cuuugauagcuuugcugucua 
5'   acu    ucug cauuuugcaaucgaacaa  ccuuagu             ucggaccuugu    ugcuga acaaag                     g
     |||    |||| ||||||||||||||||||  |||||||             |||||||||||    |||||| ||||||                      
3'   uga    ggac guagaacguuagcuuguu  ggaauca             aguuuggaacg    acgacu uguuuc                     a
   cu   --uu    a                  cc       -------------           aaug      u      acaaaucgagguucuauuaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 25442100-25442286 [+]
intergenic
Database links

Mature sequence bdi-miR9487

Accession MIMAT0035494
Sequence

156 - 

ccuuguucgauugcaagauga

 - 176

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).