Stem-loop sequence bdi-MIR9488

AccessionMI0029137 (change log)
DescriptionBrachypodium distachyon miR9488 stem-loop
Stem-loop
   --        gc    c                u  g     a  g     cu   --    uaccug    -ua       uugccccgcaaaauauc 
5'   cauugagg  uagg uuuuauguaacuacug uu uggua uu uuuuu  aaa  aucc      uuaa   gcacuga                 a
     ||||||||  |||| |||||||||||||||| || ||||| || |||||  |||  ||||      ||||   |||||||                 c
3'   guaacucc  aucc aaaauguauugaugac aa accau aa aaaag  uuu  uagg      aguu   cgugacu                 u
   uu        uu    -                c  a     c  g     uu   ug    --ccaa    caa       acaguuaagacugcaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 50046751-50046943 [-]
intergenic
Database links

Mature sequence bdi-miR9488

Accession MIMAT0035495
Sequence

4 - 

ugagggcuaggcuuuuauguaa

 - 25

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).