Stem-loop sequence bdi-MIR9489

AccessionMI0029138 (change log)
DescriptionBrachypodium distachyon miR9489 stem-loop
Stem-loop 
   --      c   auucug  a  g               c      a  c  a   c     gc 
5'   gugugu ugg      ga ca uuucagcuccacgga uuggug ag ug uua ucaua  u
     |||||| |||      || || ||||||||||||||| |||||| || || ||| |||||   
3'   uacaca acc      cu gu gagguugaggugucu aaccac uc au agu aguau  u
   cc      a   ------  a  -               a      c  u  c   a     ac
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 49503475-49503595 [-]
intergenic
Database links

Mature sequence bdi-miR9489

Accession MIMAT0035496
Sequence

25 -  

ucagcuccacggacuugguga

 - 45

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).