Stem-loop sequence bdi-MIR9486b

AccessionMI0029139 (change log)
DescriptionBrachypodium distachyon miR9486b stem-loop
Gene family MIPF0002054; MIR9486
Stem-loop
   gaug    a    g           gc        u    c   g    uaaa     aaagaau   a 
5'     agau aaaa uggaaccucug  cacuuaaa guau uua gaaa    aaccu       ccu c
       |||| |||| |||||||||||  |||||||| |||| ||| ||||    |||||       ||| c
3'     ucua uuuu accuuggagau  gugaauuu caua aau cuuu    uuggg       gga u
   ---a    c    g           ua        u    a   g    ----     ------c   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 10710427-10710554 [-]
intergenic
Database links

Mature sequence bdi-miR9486b

Accession MIMAT0035497
Sequence

99 - 

uaagugauuagagguuccagu

 - 119

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).