Stem-loop sequence bdi-MIR9486b

Accession

MI0029139 (change log)

Description

Brachypodium distachyon miR9486b stem-loop

Gene family

MIPF0002054; MIR9486

Stem-loop

   gaug    a    g           gc        u    c   g    uaaa     aaagaau   a 
5'     agau aaaa uggaaccucug  cacuuaaa guau uua gaaa    aaccu       ccu c
       |||| |||| |||||||||||  |||||||| |||| ||| ||||    |||||       ||| c
3'     ucua uuuu accuuggagau  gugaauuu caua aau cuuu    uuggg       gga u
   ---a    c    g           ua        u    a   g    ----     ------c   c 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Bd21; GCA_000005505.1): 3: 10710427-10710554 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0029139

Mature sequence bdi-miR9486b

• Accession: MIMAT0035497
• Sequence: 99 - uaagugauuagagguuccagu - 119
• Evidence: not experimental

References

1. PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).