Stem-loop sequence bdi-MIR9490

AccessionMI0029140 (change log)
DescriptionBrachypodium distachyon miR9490 stem-loop
Stem-loop
   --        g            aa        c    gu    uga 
5'   cuuagugc aggccacacccu  uggucgug gggu  cuug   a
     |||||||| ||||||||||||  |||||||| ||||  ||||    
3'   gaaucgcg uucgguguggga  aucggcac cccg  gaac   a
   cc        g            ag        a    --    cga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 18715092-18715183 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR9490
bdi-MIR77093: 18724294-18724682 [-]
bdi-MIR94903: 18715092-18715183 [-]
Database links

Mature sequence bdi-miR9490

Accession MIMAT0035498
Sequence

10 - 

aggccacacccuaauggucgugcg

 - 33

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).