Stem-loop sequence bdi-MIR9481b

AccessionMI0029141 (change log)
DescriptionBrachypodium distachyon miR9481b stem-loop
Gene family MIPF0002096; MIR9481
Stem-loop
   --       ac      c        u        --a      uuu         a  --c    uaaa 
5'   ugcagau  ggaggu aggaauuc acugguuu   acuaaa   cauucgaca ga   aaag    a
     |||||||  |||||| |||||||| ||||||||   ||||||   ||||||||| ||   ||||     
3'   acgucua  cuucca ucuuuagg ugacuaaa   ugauuu   guaagcugu uu   uuuc    a
   cu       aa      c        c        agg      -uu         a  aac    ucaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 4929512-4929646 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR9481b
bdi-MIR9481a4: 4930203-4930325 [-]
bdi-MIR9481b4: 4929512-4929646 [-]
Database links

Mature sequence bdi-miR9481b

Accession MIMAT0035499
Sequence

104 - 

ucagucggauuucucaccuuc

 - 124

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).