Stem-loop sequence bdi-MIR9491

AccessionMI0029142 (change log)
DescriptionBrachypodium distachyon miR9491 stem-loop
Stem-loop
   --      g   g                 a              a  c 
5'   ugcuuu uau guauguuaccucugauc guacuccguugcuu ua a
     |||||| ||| ||||||||||||||||| |||||||||||||| ||  
3'   acgaaa aua cauacaauggagacuag caugaggcaacgaa au g
   ca      a   a                 c              a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 14711883-14711980 [+]
intergenic
Database links

Mature sequence bdi-miR9491

Accession MIMAT0035500
Sequence

10 - 

ugguauguuaccucugaucag

 - 30

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).