Stem-loop sequence bdi-MIR9492

AccessionMI0029143 (change log)
DescriptionBrachypodium distachyon miR9492 stem-loop
Stem-loop
   --guu   c  a  ua    g              g   c    u 
5'      guu cu uc  cucu ucaugguaucagag cuu acgc c
        ||| || ||  |||| |||||||||||||| ||| |||| u
3'      uaa ga ag  gagg aguaccauagucuc gga ugcg c
   gucug   a  a  gc    a              g   u    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 25584132-25584222 [-]
intergenic
Database links

Mature sequence bdi-miR9492

Accession MIMAT0035501
Sequence

9 - 

uaucuacucugucaugguauc

 - 29

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).