Stem-loop sequence bdi-MIR9494

AccessionMI0029145 (change log)
DescriptionBrachypodium distachyon miR9494 stem-loop
Stem-loop
   --   a            ga    a        c  c   acg      ccgccggcggcggcggcggccacgggca 
5'   ggg agaggacggagg  gagg ugaugaag cg agc   gggcgc                            c
     ||| ||||||||||||  |||| |||||||| || |||   ||||||                            g
3'   uuc ucuccugccucu  uucc acuacuuc gc ucg   cucgcg                            g
   ac   a            gc    -        c  -   -ca      caugcuccaguccuugccccgggaggcg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 2643359-2643510 [+]
intergenic
Database links

Mature sequence bdi-miR9494

Accession MIMAT0035503
Sequence

122 - 

uucaucaccuucgucuccguc

 - 142

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).