![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bdi-MIR9495 |
|||||
Accession | MI0029146 (change log) | ||||
Description | Brachypodium distachyon miR9495 stem-loop | ||||
Stem-loop |
-- u c uc ucu a auc 5' uuuugaaaaaugcc cugga gug aaug ugu gg u |||||||||||||| ||||| ||| |||| ||| || 3' aaagcuuuuuacgg gaccu cac uuac gca cc g gu u a uc uau - cag |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bdi-miR9495 |
|
Accession | MIMAT0035504 |
Sequence |
4 - ugaaaaaugccucuggacgug - 24 |
Evidence | not experimental |
References |
|
1 |
PMID:24367943
"Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon"
Genome Biol. 14:R145(2013).
|