Stem-loop sequence bdi-MIR9495

AccessionMI0029146 (change log)
DescriptionBrachypodium distachyon miR9495 stem-loop
Stem-loop
   --              u     c   uc    ucu   a  auc 
5'   uuuugaaaaaugcc cugga gug  aaug   ugu gg   u
     |||||||||||||| ||||| |||  ||||   ||| ||    
3'   aaagcuuuuuacgg gaccu cac  uuac   gca cc   g
   gu              u     a   uc    uau   -  cag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 7679238-7679324 [-]
intergenic
Database links

Mature sequence bdi-miR9495

Accession MIMAT0035504
Sequence

4 - 

ugaaaaaugccucuggacgug

 - 24

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).