Stem-loop sequence bdi-MIR9497

AccessionMI0029148 (change log)
DescriptionBrachypodium distachyon miR9497 stem-loop
Stem-loop
   --     cc       g      u       c u    -c        u     g               ua  uu       au  aa       c    ccacaauuuucaguaaguaguu 
5'   ucccu  uuuuucu aauaca gguguau a guuu  uuaagaca ggcuu gaccaagaauuacuu  uu  auaugug  gu  uaugaua gaaa                      u
     |||||  ||||||| |||||| ||||||| | ||||  |||||||| ||||| |||||||||||||||  ||  |||||||  ||  ||||||| ||||                      u
3'   aggga  aaaaaga uuaugu ccacaua u uaaa  aguucugu ccgaa cugguuuuuaaugaa  ag  uaugcac  ca  auacugu cuuu                      g
   ug     -u       g      c       u c    uc        u     a               gc  -u       -c  -a       a    aaacguaguggucuagguagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 49315484-49315725 [-]
intergenic
Database links

Mature sequence bdi-miR9497

Accession MIMAT0035506
Sequence

10 - 

uuucugaauacaugguguauc

 - 30

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).