Stem-loop sequence bdi-MIR9499

AccessionMI0029150 (change log)
DescriptionBrachypodium distachyon miR9499 stem-loop
Stem-loop
   --  g  -    u             g    - --a         
5'   uc uc uccc cgucgacgcggca cuca g   aggcgcgc 
     || || |||| ||||||||||||| |||| |   ||||||| g
3'   ag ag aggg gcggcugugccgu gagu c   uccgugca 
   cc  g  c    -             a    g gcg         
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 17265172-17265253 [-]
intergenic
Database links

Mature sequence bdi-miR9499

Accession MIMAT0035508
Sequence

7 - 

cccucgucgacgcggcagcuc

 - 27

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).