Stem-loop sequence bdi-MIR9499

Accession

MI0029150 (change log)

Description

Brachypodium distachyon miR9499 stem-loop

Stem-loop

   --  g  -    u             g    - --a         
5'   uc uc uccc cgucgacgcggca cuca g   aggcgcgc 
     || || |||| ||||||||||||| |||| |   ||||||| g
3'   ag ag aggg gcggcugugccgu gagu c   uccgugca 
   cc  g  c    -             a    g gcg         

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Bd21; GCA_000005505.1): 4: 17265172-17265253 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0029150

Mature sequence bdi-miR9499

• Accession: MIMAT0035508
• Sequence: 7 - cccucgucgacgcggcagcuc - 27
• Evidence: not experimental

References

1. PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).