Stem-loop sequence bdi-MIR156j

AccessionMI0029151 (change log)
DescriptionBrachypodium distachyon miR156j stem-loop
Gene family MIPF0000008; MIR156
Literature search

5 open access papers mention bdi-MIR156j
(25 sentences)

Stem-loop
   --  g        -    -          --a   -a  ac     ugaaac     -    
5'   gu augacaga agag agagagcaca   ccc  gc  cagcg      accgg ccg 
     || |||||||| |||| ||||||||||   |||  ||  |||||      ||||| || u
3'   cg uacugucu ucuc ucucucgugu   ggg  cg  gucgc      uggcc ggc 
   ac  g        c    g          gcc   aa  ga     ------     c    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 38856201-38856309 [-]
intergenic
Database links

Mature sequence bdi-miR156j

Accession MIMAT0035509
Sequence

5 - 

ugacagaagagagagagcac

 - 24

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).