Stem-loop sequence bdi-MIR159c

AccessionMI0029152 (change log)
DescriptionBrachypodium distachyon miR159c stem-loop
   --       aacaacauu     a  a   a   ---    aaaaa  -   u  -ca         gugcgacauacccugaucucgu 
5'   uacccaa         uagag cc ucc uca   caag     ag agu gc   aggggcagc                      c
     |||||||         ||||| || ||| |||   ||||     || ||| ||   |||||||||                      c
3'   guggguu         gucuc gg ggg agu   guuu     uc ucg cg   uccucgucg                      u
   cg       ---------     -  -   a   uug    acaug  g   u  ucg         gggcgccgcggccgcggcuggc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 302390-302552 [-]
Database links

Mature sequence bdi-miR159c

Accession MIMAT0035510

134 - 


 - 154

Get sequence
Evidence not experimental


PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).