Stem-loop sequence bdi-MIR160f

AccessionMI0029153 (change log)
DescriptionBrachypodium distachyon miR160f stem-loop
Gene family MIPF0000032; MIR160
Literature search

2 open access papers mention bdi-MIR160f
(5 sentences)

Stem-loop
   --    -   -       u g -  -    -  g gug   -    agg   ga -  -c    g     u 
5'   cggg ggc ugcgggg g c gg augu ca u   cgg ccgu   cug  c cg  gggu uuugc g
     |||| ||| ||||||| | | || |||| || |   ||| ||||   |||  | ||  |||| |||||  
3'   gccc ccg auguccc c g cc uacg gu a   gcc ggca   ggc  g gc  ccua aggcg u
   gc    g   u       u g u  g    c  g --a   a    -ga   ag a  ca    g     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 19337418-19337548 [-]
intergenic
Database links

Mature sequence bdi-miR160f

Accession MIMAT0035511
Sequence

105 - 

ugccuggcucccuguaugcc

 - 124

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).