Stem-loop sequence bdi-MIR167f

AccessionMI0029155 (change log)
DescriptionBrachypodium distachyon miR167f stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

2 open access papers mention bdi-MIR167f
(7 sentences)

Stem-loop
   --     ag     a    c   -           uuu      -     ug 
5'   gugaa  aguga gcug cag caugaucuagc   gaucca augua  u
     |||||  ||||| |||| ||| |||||||||||   |||||| |||||   
3'   cgcuu  uuacu cgac guc guacuagauug   cuaggu ugcau  c
   aa     cu     c    a   c           uuc      g     cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 1643731-1643832 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR167f
bdi-MIR167f4: 1643731-1643832 [-]
bdi-MIR167e4: 1641440-1641565 [-]
Database links

Mature sequence bdi-miR167f

Accession MIMAT0035513
Sequence

10 - 

ugaagcugccagcaugaucua

 - 30

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).