Stem-loop sequence bdi-MIR167g

AccessionMI0029156 (change log)
DescriptionBrachypodium distachyon miR167g stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

2 open access papers mention bdi-MIR167g
(7 sentences)

Stem-loop
   ----cu     -    ca  u               c        aacucca   -ac    u  gua  u  -    u     c      u 
5'       ugugc gcca  ag agaugaagcugccag augaucug       cgc   caca gu   uc ug gugc gugua ucgauc u
         ||||| ||||  || ||||||||||||||| ||||||||       |||   |||| ||   || || |||| ||||| ||||||  
3'       acacg cggu  uc uuuacuucgacgguc uacuagac       gcg   gugu ca   ag ac cacg uacau aguuag c
   ccggcc     a    ac  u               -        --gucua   gac    -  aag  u  g    -     u      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 71590930-71591103 [-]
intergenic
Database links

Mature sequence bdi-miR167g

Accession MIMAT0035514
Sequence

20 - 

ugaagcugccagcaugaucuga

 - 41

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).