Stem-loop sequence bdi-MIR169l

AccessionMI0029157 (change log)
DescriptionBrachypodium distachyon miR169l stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

3 open access papers mention bdi-MIR169l
(27 sentences)

Stem-loop
            ag     a        -  ---    uu   ga    a 
5' auguagcca  gauga uugccggc cg   gcgu  guc  uggu c
   |||||||||  ||||| |||||||| ||   ||||  |||  |||| u
3' ugcaucggu  uuacu aacggccg gu   cgcg  uag  gccg c
            gu     g        a  uag    -c   ag    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 35762160-35762251 [-]
intergenic
Database links

Mature sequence bdi-miR169l

Accession MIMAT0035515
Sequence

4 - 

uagccaaggaugaauugccgg

 - 24

Get sequence
Evidence not experimental

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).